RESUMO
Obesity and overweight are common and complex conditions influenced by multiple genetic and environmental factors. Several genetic variants located in the genes involved in clock systems and fat taste perception can affect metabolic health. In particular, the polymorphisms in CLOCK and BMAL1 genes were reported to be significantly related to cardiovascular disease, metabolic syndrome, sleep reduction, and evening preference. Moreover, genetic variants in the CD36 gene have been shown to be involved in lipid metabolism, regulation of fat intake, and body weight regulation. The aim of this study is to evaluate, for the first time, the association between variants in some candidate genes (namely, BMAL1 rs7950226 (G>A), CLOCK rs1801260 (A>G), CLOCK rs4864548 (G>A), CLOCK rs3736544 (G>A), CD36 rs1984112 (A>G), CD36 rs1761667 (G>A)) and overweight/obesity (OB) in pregnant women. A total of 163 normal-weight (NW) and 128 OB participants were included. A significant correlation was observed between A-allele in CLOCK rs4864548 and an increased risk of obesity (OR: 1.97; 95% CI 1.22-3.10, p = 0.005). In addition, we found that subjects carrying the haplotype of rs1801260-A, rs4864548-A, and rs3736544-G are likely to be overweight or obese (OR 1.47, 95% CI 1.03-2.09, p = 0.030), compared with those with other haplotypes. Moreover, a significant relation was observed between third-trimester lipid parameters and genetic variants-namely, CD36 rs1984112, CD36 rs1761667, BMAL1 rs7950226, and CLOCK rs1801260. A multivariate logistic regression model revealed that CLOCK rs4864548 A-allele carriage was a strong risk factor for obesity (OR 2.05, 95% CI 1.07-3.93, p = 0.029); on the other hand, greater adherence to Mediterranean diet (OR 0.80, 95% CI 0.65-0.98, p = 0.038) and higher HDL levels (OR 0.96, 95% CI 0.94-0.99, p = 0.021) were related to a reduced risk of obesity. Interestingly, an association between maternal CLOCK rs4864548 and neonatal birthweight was detected (p = 0.025). These data suggest a potential role of the polymorphisms in clock systems and in fat taste perception in both susceptibility to overweight/obesity and influencing the related metabolic traits in pregnant women.
Assuntos
Fatores de Transcrição ARNTL , Sobrepeso , Gravidez , Recém-Nascido , Feminino , Humanos , Sobrepeso/genética , Fatores de Transcrição ARNTL/genética , Gestantes , Obesidade/genética , Alelos , Antígenos CD36/genéticaRESUMO
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Assuntos
Transtornos Plaquetários , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Dados Factuais , RNARESUMO
Exosomes, which are small membrane-encapsulated particles derived from all cell types, are emerging as important mechanisms for intercellular communication. In addition, exosomes are currently envisioned as potential carriers for the delivery of drugs to target tissues. The natural population of exosomes is very variable due to the limited amount of cargo components present in these small vesicles. Consequently, common components of exosomes may play a role in their function. We have proposed that membrane phospholipids could be a common denominator in the effect of exosomes on cellular functions. In this regard, we have previously shown that liposomes made of phosphatidylcholine (PC) or phosphatidylserine (PS) induced a robust alteration of macrophage (MÏ) gene expression. We herewith report that these two phospholipids modulate gene expression in MÏs by different mechanisms. PS alters cellular responses by the interaction with surface receptors, particularly CD36. In contrast, PC is captured by a receptor-independent process and likely triggers an activity within endocytic vesicles. Despite this difference in the capture mechanisms, both lipids mounted similar gene expression responses. This investigation suggests that multiple mechanisms mediated by membrane phospholipids could be participating in the alteration of cellular functions by exosomes.
Assuntos
Exossomos , Macrófagos , Fosfatidilserinas , Macrófagos/metabolismo , Animais , Camundongos , Fosfatidilserinas/metabolismo , Exossomos/metabolismo , Fosfatidilcolinas/metabolismo , Inflamação/metabolismo , Fosfolipídeos/metabolismo , Camundongos Endogâmicos C57BL , Antígenos CD36/metabolismo , Antígenos CD36/genética , LipossomosRESUMO
Deep proteomic profiling of rare cell populations has been constrained by sample input requirements. Here, we present DROPPS (droplet-based one-pot preparation for proteomic samples), an accessible low-input platform that generates high-fidelity proteomic profiles of 100-2,500 cells. By applying DROPPS within the mammary epithelium, we elucidated the connection between mitochondrial activity and clonogenicity, identifying CD36 as a marker of progenitor capacity in the basal cell compartment. We anticipate that DROPPS will accelerate biology-driven proteomic research for a multitude of rare cell populations.
Assuntos
Biomarcadores , Antígenos CD36 , Glândulas Mamárias Animais , Proteômica , Células-Tronco , Proteômica/métodos , Antígenos CD36/metabolismo , Animais , Feminino , Células-Tronco/metabolismo , Glândulas Mamárias Animais/citologia , Glândulas Mamárias Animais/metabolismo , Biomarcadores/metabolismo , Biomarcadores/análise , Epitélio/metabolismo , Camundongos , Humanos , Mitocôndrias/metabolismoRESUMO
Inflammation is a mediator of a number of chronic pathologies. We synthesized the diethyl (9Z,12Z)-octadeca-9,12-dien-1-ylphosphonate, called NKS3, which decreased lipopolysaccharide (LPS)-induced mRNA upregulation of proinflammatory cytokines (IL-1ß, IL-6 and TNF-α) not only in primary intraperitoneal and lung alveolar macrophages, but also in freshly isolated mice lung slices. The in-silico studies suggested that NKS3, being CD36 agonist, will bind to GPR120. Co-immunoprecipitation and proximity ligation assays demonstrated that NKS3 induced protein-protein interaction of CD36 with GPR120in RAW 264.7 macrophage cell line. Furthermore, NKS3, via GPR120, decreased LPS-induced activation of TAB1/TAK1/JNK pathway and the LPS-induced mRNA expression of inflammatory markers in RAW 264.7 cells. In the acute lung injury model, NKS3 decreased lung fibrosis and inflammatory cytokines (IL-1ß, IL-6 and TNF-α) and nitric oxide (NO) production in broncho-alveolar lavage fluid. NKS3 exerted a protective effect on LPS-induced remodeling of kidney and liver, and reduced circulating IL-1ß, IL-6 and TNF-α concentrations. In a septic shock model, NKS3 gavage decreased significantly the LPS-induced mortality in mice. In the last, NKS3 decreased neuroinflammation in diet-induced obese mice. Altogether, these results suggest that NKS3 is a novel anti-inflammatory agent that could be used, in the future, for the treatment of inflammation-associated pathologies.
Assuntos
Endotoxemia , Animais , Camundongos , Endotoxemia/induzido quimicamente , Interleucina-6/genética , Lipopolissacarídeos/toxicidade , Fator de Necrose Tumoral alfa , Anti-Inflamatórios/farmacologia , Anti-Inflamatórios/uso terapêutico , Inflamação , Antígenos CD36/genética , Citocinas/genética , Interleucina-1beta/genética , RNA Mensageiro , Ácidos GraxosRESUMO
BACKGROUND & AIMS: CD36, a membrane protein widely present in various tissues, is crucial role in regulating energy metabolism. The rise of HCC as a notable outcome of NAFLD is becoming more apparent. Patients with hereditary CD36 deficiency are at increased risk of NAFLD. However, the impact of CD36 deficiency on NAFLD-HCC remains unclear. METHODS: Global CD36 knockout mice (CD36KO) and wild type mice (WT) were induced to establish NAFLD-HCC model by N-nitrosodiethylamine (DEN) plus high fat diet (HFD). Transcriptomics was employed to examine genes that were expressed differentially. RESULTS: Compared to WT mice, CD36KO mice showed more severe HFD-induced liver issues and increased tumor malignancy. The MEK1/2-ERK1/2 pathway activation was detected in the liver tissues of CD36KO mice using RNA sequencing and Western blot analysis. CONCLUSION: Systemic loss of CD36 leaded to the advancement of NAFLD to HCC by causing lipid disorders and metabolic inflammation, a process that involves the activation of MAPK signaling pathway. We found that CD36 contributes significantly to the maintenance of metabolic homeostasis in NAFLD-HCC.
Assuntos
Transtornos Plaquetários , Carcinoma Hepatocelular , Doenças Genéticas Inatas , Neoplasias Hepáticas , Hepatopatia Gordurosa não Alcoólica , Humanos , Animais , Camundongos , Hepatopatia Gordurosa não Alcoólica/metabolismo , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/metabolismo , Sistema de Sinalização das MAP Quinases , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/metabolismo , Fígado/metabolismo , Transdução de Sinais , Antígenos CD36/genética , Antígenos CD36/metabolismo , Dieta Hiperlipídica/efeitos adversos , Camundongos Endogâmicos C57BL , Camundongos KnockoutRESUMO
Background: Obesity leads to an elevated risk of developing gastrointestinal disease such as gastric ulcers. Callistemon citrinus leaf extract has shown antioxidant, antimicrobial, hepatoprotective, and chemoprotective effects against colon cancer. The aim of this study is to evaluate the gastroprotective effect of C. citrinus leaf extract on indomethacin-induced gastric ulcers in obese rats. Methods: Gastric ulcers were induced in female obese Wistar rats using a single oral dose of indomethacin (IND). In the first stage, the rats were fed with a high fat sugar diet (HFSD) for 15 weeks to induce obesity and, at the same time, the diet of the other group of animals included daily administration of ethanolic C. citrinus leaf extract (250 mg/kg) in addition to HFSD. In the second stage, gastric ulcers were induced with IND (30 mg/kg). The gastroprotective activity of C. citrinus, the inflammatory enzyme activities, and cytokines in the stomach were determined. Results: C. citrinus produced a reduction of gastric lesions caused by IND. Myeloperoxidase (MPO), cyclooxygenase-2 (COX-2), and 5-lipoxygenase (5-LOX) activities also decreased. Although inflammatory biomarkers such as TNFα, IL-6, AOPP, and leptin were significantly decreased by C. citrinus, adiponectin levels increased. Moreover, C. citrinus decreased weight gain and morphological and biochemical parameters. Conclusion: The use of indomethacin in rats fed with a high fat-sugar diet increased gastric ulcers. Gastroprotective effect of C. citrinus in obese rats is attributed to the reduction of pro-inflammatory cytokines and the inflammatory enzymes.
Assuntos
Indometacina , Úlcera Gástrica , Feminino , Ratos , Animais , Úlcera Gástrica/induzido quimicamente , Ratos Wistar , Anti-Inflamatórios , Obesidade/complicações , Antígenos CD36 , Açúcares , Citocinas , Extratos Vegetais/farmacologiaRESUMO
BACKGROUND: Atherosclerosis (AS) is a persistent inflammatory condition triggered and exacerbated by several factors including lipid accumulation, endothelial dysfunction and macrophages infiltration. Nobiletin (NOB) has been reported to alleviate atherosclerosis; however, the underlying mechanism remains incompletely understood. METHODS: This study involved comprehensive bioinformatic analysis, including multidatabase target prediction; GO and KEGG enrichment analyses for function and pathway exploration; DeepSite and AutoDock for drug binding site prediction; and CIBERSORT for immune cell involvement. In addition, target intervention was verified via cell scratch assays, oil red O staining, ELISA, flow cytometry, qRTâPCR and Western blotting. In addition, by establishing a mouse model of AS, it was demonstrated that NOB attenuated lipid accumulation and the extent of atherosclerotic lesions. RESULTS: (1) Altogether, 141 potentially targetable genes were identified through which NOB could intervene in atherosclerosis. (2) Lipid and atherosclerosis, fluid shear stress and atherosclerosis may be the dominant pathways and potential mechanisms. (3) ALB, AKT1, CASP3 and 7 other genes were identified as the top 10 target genes. (4) Six genes, including PPARG, MMP9, SRC and 3 other genes, were related to the M0 fraction. (5) CD36 and PPARG were upregulated in atherosclerosis samples compared to the normal control. (6) By inhibiting lipid uptake in RAW264.7 cells, NOB prevents the formation of foam cell. (7) In RAW264.7 cells, the inhibitory effect of oxidized low-density lipoprotein on foam cells formation and lipid accumulation was closely associated with the PPARG signaling pathway. (8) In vivo validation showed that NOB significantly attenuated intra-arterial lipid accumulation and macrophage infiltration and reduced CD36 expression. CONCLUSIONS: Nobiletin alleviates atherosclerosis by inhibiting lipid uptake via the PPARG/CD36 pathway.
Assuntos
Aterosclerose , Flavonas , PPAR gama , Animais , Camundongos , PPAR gama/genética , PPAR gama/metabolismo , Aterosclerose/tratamento farmacológico , Aterosclerose/genética , Aterosclerose/metabolismo , Macrófagos , Células Espumosas , Lipoproteínas LDL/farmacologia , Antígenos CD36/genética , Antígenos CD36/metabolismoRESUMO
Cluster of differentiation 36 (CD36) is a scavenger receptor (SR), recognizing diverse extracellular ligands in various types of mammalian cells. Long-chain fatty acids (FAs), which are important constituents of phospholipids and triglycerides, also utilize CD36 as a predominant membrane transporter, being incorporated from the circulation across the plasma membrane in several cell types, including cardiac and skeletal myocytes and adipocytes. CD36 is localized in intracellular vesicles as well as the plasma membrane, and its distribution is modulated by extracellular stimuli. Herein, we aimed to clarify the molecular basis of insulin-stimulated translocation of CD36, which leads to the enhanced uptake of long-chain FAs, in adipocytes. To this end, we developed a novel exofacial epitope-tagged reporter to specifically detect cell surface-localized CD36. By employing this reporter, we demonstrate that the small GTPase Rac1 plays a pivotal role in insulin-stimulated translocation of CD36 to the plasma membrane in 3T3-L1 adipocytes. Additionally, phosphoinositide 3-kinase and the protein kinase Akt2 are shown to be involved in the regulation of Rac1. Downstream of Rac1, another small GTPase RalA directs CD36 translocation. Collectively, these results suggest that CD36 is translocated to the plasma membrane by insulin through mechanisms similar to those for the glucose transporter GLUT4 in adipocytes.
Assuntos
Insulina , Proteínas Monoméricas de Ligação ao GTP , Animais , Adipócitos/metabolismo , Antígenos CD36/metabolismo , Membrana Celular/metabolismo , Ácidos Graxos/metabolismo , Glucose/metabolismo , Transportador de Glucose Tipo 4/metabolismo , Insulina/farmacologia , Insulina/metabolismo , Proteínas de Membrana Transportadoras/metabolismo , Fosfatidilinositol 3-Quinases/metabolismo , Transporte Proteico , Transdução de Sinais , CamundongosRESUMO
Amyloid-beta (Aß) is a key factor in the onset and progression of Alzheimer's disease (AD). Selenium (Se) compounds show promise in AD treatment. Here, we revealed that selenoprotein K (SELENOK), a selenoprotein involved in immune regulation and potentially related to AD pathology, plays a critical role in microglial immune response, migration, and phagocytosis. In vivo and in vitro studies corroborated that SELENOK deficiency inhibits microglial Aß phagocytosis, exacerbating cognitive deficits in 5xFAD mice, which are reversed by SELENOK overexpression. Mechanistically, SELENOK is involved in CD36 palmitoylation through DHHC6, regulating CD36 localization to microglial plasma membranes and thus impacting Aß phagocytosis. CD36 palmitoylation was reduced in the brains of patients and mice with AD. Se supplementation promoted SELENOK expression and CD36 palmitoylation, enhancing microglial Aß phagocytosis and mitigating AD progression. We have identified the regulatory mechanisms from Se-dependent selenoproteins to Aß pathology, providing novel insights into potential therapeutic strategies involving Se and selenoproteins.
Assuntos
Doença de Alzheimer , Antígenos CD36 , Microglia , Selenoproteínas , Animais , Humanos , Camundongos , Doença de Alzheimer/genética , Doença de Alzheimer/metabolismo , Peptídeos beta-Amiloides/metabolismo , Modelos Animais de Doenças , Lipoilação , Camundongos Transgênicos , Microglia/metabolismo , Fagocitose , Selenoproteínas/genética , Selenoproteínas/metabolismo , Antígenos CD36/metabolismoRESUMO
Metastasis causes most cancer-related deaths, and the role and mechanism of periostin (POSTN) in the metastasis of hepatocellular carcinoma (HCC) remain undiscovered. In this study, DEN and HTVi HCC models were performed in hepatic-specific Postn ablation and Postn knock-in mouse to reveal the role of POSTN in HCC metastasis. Furthermore, POSTN was positively correlated with circulating EPCs level and promoted EPC mobilization and tumour infiltration. POSTN also mediated the crosstalk between HCC and EPCs, which promoted metastasis ability and upregulated CD36 expression in HCC through indirect crosstalk. Chemokine arrays further revealed that hepatic-derived POSTN induced elevated CCL2 expression and secretion in EPCs, and CCL2 promoted prometastatic traits in HCC. Mechanistic studies showed that POSTN upregulated CCL2 expression in EPCs via the αvß3/ILK/NF-κB pathway. CCL2 further induced CD36 expression via the CCR2/STAT3 pathway by directly binding to the promoter region of CD36. Finally, CD36 was verified to have a prometastatic role in vitro and to be correlated with POSTN expression, metastasis and recurrence in HCC in clinical samples. Our findings revealed that crosstalk between HCC and EPCs is mediated by periostin/CCL2/CD36 signalling which promotes HCC metastasis and emphasizes a potential therapeutic strategy for preventing HCC metastasis.
Assuntos
Antígenos CD36 , Carcinoma Hepatocelular , Quimiocina CCL2 , Células Progenitoras Endoteliais , Neoplasias Hepáticas , 60491 , Animais , Camundongos , Carcinoma Hepatocelular/patologia , Células Progenitoras Endoteliais/metabolismo , Células Progenitoras Endoteliais/patologia , Neoplasias Hepáticas/patologia , Transdução de Sinais/genética , Microambiente Tumoral/genética , Quimiocina CCL2/metabolismo , Antígenos CD36/metabolismoRESUMO
Lung cancer is the most common cause of cancer-related deaths worldwide and is caused by multiple factors, including high-fat diet (HFD). CD36, a fatty acid receptor, is closely associated with metabolism-related diseases, including cardiovascular disease and cancer. However, the role of CD36 in HFD-accelerated non-small-cell lung cancer (NSCLC) is unclear. In vivo, we fed C57BL/6J wild-type (WT) and CD36 knockout (CD36-/-) mice normal chow or HFD in the presence or absence of pitavastatin 2 weeks before subcutaneous injection of LLC1 cells. In vitro, A549 and NCI-H520 cells were treated with free fatty acids (FFAs) to mimic HFD situation for exploration the underlying mechanisms. We found that HFD promoted LLC1 tumor growth in vivo and that FFAs increased cell proliferation and migration in A549 and NCI-H520 cells. The enhanced cell or tumor growth was inhibited by the lipid-lowering agent pitavastatin, which reduced lipid accumulation. More importantly, we found that plasma soluble CD36 (sCD36) levels were higher in NSCLC patients than those in healthy ones. Compared to that in WT mice, the proliferation of LLC1 cells in CD36-/- mice was largely suppressed, which was further repressed by pitavastatin in HFD group. At the molecular level, we found that CD36 inhibition, either with pitavastatin or plasmid, reduced proliferation- and migration-related protein expression through the AKT/mTOR pathway. Taken together, we demonstrate that inhibition of CD36 expression by pitavastatin or other inhibitors may be a viable strategy for NSCLC treatment.
Assuntos
Antígenos CD36 , Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , Animais , Humanos , Camundongos , Carcinoma Pulmonar de Células não Pequenas/tratamento farmacológico , Ácidos Graxos , Neoplasias Pulmonares/tratamento farmacológico , Camundongos Endogâmicos C57BL , Proteínas Proto-Oncogênicas c-akt , Antígenos CD36/genéticaRESUMO
BACKGROUND AND AIMS: Atherosclerosis (AS) is a continuously low-grade inflammatory disease, and monocyte-derived macrophages play a vital role in AS pathogenesis. Regulatory factor X1 (RFX1) has been reported to participate in differentiation of various cells. Our previous report showed that RFX1 expression in CD14+ monocytes from AS patients was decreased and closely related to AS development. Macrophages mostly derive from monocytes and play an important role in AS plaque formation and stability. However, the functions of RFX1 in the formation of macrophage-derived foam cells and consequent AS development are unclear. METHODS: We explored the effects of RFX1 on oxidation low lipoprotein (ox-LDL)-stimulated foam cell formation and CD36 expression by increasing or silencing Rfx1 expression in mouse peritoneal macrophages (PMAs). The ApoE-/-Rfx1f/f or ApoE-/-Rfx1f/f Lyz2-Cre mice fed a high-fat diet for 24 weeks were used to further examine the effect of RFX1 on AS pathogenesis. We then performed dual luciferase reporter assays to study the regulation of RFX1 for CD36 transcription. RESULTS: Our results demonstrate that RFX1 expression was significantly reduced in ox-LDL induced foam cells and negatively correlated with lipid uptake in macrophages. Besides, Rfx1 deficiency in myeloid cells aggravated atherosclerotic lesions in ApoE-/- mice. Mechanistically, RFX1 inhibited CD36 expression by directly regulating CD36 transcription in macrophages. CONCLUSIONS: The reduction of RFX1 expression in macrophages is a vital determinant for foam cell formation and the initiation of AS, proving a potential novel approach for the treatment of AS disease.
Assuntos
Aterosclerose , Antígenos CD36 , Células Espumosas , Animais , Humanos , Camundongos , Apolipoproteínas E/metabolismo , Aterosclerose/metabolismo , Células Espumosas/citologia , Células Espumosas/metabolismo , Lipoproteínas LDL/metabolismo , Fator Regulador X1/metabolismo , Antígenos CD36/metabolismoRESUMO
OBJECTIVES: To observe the effects of Lizhong Tongmai acupuncture (acupuncture for regulating middle jiao and promoting meridians) on trimethylamine-N-oxide (TMAO), CD36 expression, and cholesterol deposition in atherosclerotic (AS) mice, exploring potential mechanism of electroacupuncture (EA) in treating AS. METHODS: A total of 31 male SPF-grade C57BL/6J ApoE-/- mice were fed with high-fat diet for 8 weeks to establish AS model. After successful modeling, the remaining 30 mice were randomly divided into a model group, a medication group, and an EA group, with 10 mice in each group. An additional 10 normal mice of the same strain were selected as a blank group. The mice in the blank group and the model group received no intervention. The mice in the medication group were treated with intragastric administration of atorvastatin calcium. The mice in the EA group were treated with EA at "Neiguan" (PC 6), "Tianshu" (ST 25) and "Zusanli" (ST 36). The same-side "Neiguan" (PC 6) and "Zusanli" (ST 36), "Tianshu" (ST 25) and the tail of the mice were connected to the EA apparatus, with disperse-dense wave, a frequency of 2 Hz/15 Hz, and a current intensity of 0.3 mA for 10 min per session. Acupuncture was performed unilaterally per session, alternating between the left and right sides, with a frequency of once every other day. After intervention, HE staining was used to observe the pathological morphology of the aorta. Microplate assays were conducted to measure triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) levels in serum. Ultra high performance liquid chromatography-mass spectrometry technique (UPLC-MS) was employed to detect TMAO level in plasma. Western blot was performed to assess CD36 protein expression level in the aorta. Microanalysis was used to measure cholesterol ester (CE) level in the aorta and the CE/TC ratio was calculated. RESULTS: Compared with the blank group, the mice in the model group exhibited significant pathological changes of atherosclerosis, serum TG, TC, LDL-C levels were increased (P<0.01), and HDL-C level was decreased (P<0.01); the plasma TMAO level, aortic CE level, and the CE/TC ratio were increased (P<0.01), along with elevated CD36 protein expression level in the aorta (P<0.01). Compared with the model group, the mice in the medication group and the EA group showed improvements in aortic pathology, serum TG, TC, LDL-C levels were reduced, HDL-C levels were increased (P<0.05); plasma TMAO levels, aortic CE levels, and the CE/TC ratio were decreased (P<0.01), and CD36 protein expression levels were lowered (P<0.05). The serum TG and TC levels in the EA group were higher than those in the medication group (P<0.05). CONCLUSIONS: The Lizhong Tongmai acupuncture can ameliorate aortic pathological changes, regulate blood lipid levels, reduce plasma TMAO level, inhibit CD36 protein expression in the aorta, and decrease cholesterol deposition. These effects may contribute to the therapeutic mechanism of EA in treating AS.
Assuntos
Aterosclerose , Eletroacupuntura , Metilaminas , Masculino , Camundongos , Animais , Antígenos CD36/genética , LDL-Colesterol/metabolismo , Cromatografia Líquida , Camundongos Endogâmicos C57BL , Pontos de Acupuntura , Camundongos Knockout para ApoE , Espectrometria de Massas em Tandem , Aterosclerose/genética , Aterosclerose/terapia , Aterosclerose/metabolismoRESUMO
BACKGROUND: Chronic overconsumption of lipids followed by their excessive accumulation in the heart leads to cardiomyopathy. The cause of lipid-induced cardiomyopathy involves a pivotal role for the proton-pump vacuolar-type H+-ATPase (v-ATPase), which acidifies endosomes, and for lipid-transporter CD36, which is stored in acidified endosomes. During lipid overexposure, an increased influx of lipids into cardiomyocytes is sensed by v-ATPase, which then disassembles, causing endosomal de-acidification and expulsion of stored CD36 from the endosomes toward the sarcolemma. Once at the sarcolemma, CD36 not only increases lipid uptake but also interacts with inflammatory receptor TLR4 (Toll-like receptor 4), together resulting in lipid-induced insulin resistance, inflammation, fibrosis, and cardiac dysfunction. Strategies inducing v-ATPase reassembly, that is, to achieve CD36 reinternalization, may correct these maladaptive alterations. For this, we used NAD+ (nicotinamide adenine dinucleotide)-precursor nicotinamide mononucleotide (NMN), inducing v-ATPase reassembly by stimulating glycolytic enzymes to bind to v-ATPase. METHODS: Rats/mice on cardiomyopathy-inducing high-fat diets were supplemented with NMN and for comparison with a cocktail of lysine/leucine/arginine (mTORC1 [mechanistic target of rapamycin complex 1]-mediated v-ATPase reassembly). We used the following methods: RNA sequencing, mRNA/protein expression analysis, immunofluorescence microscopy, (co)immunoprecipitation/proximity ligation assay (v-ATPase assembly), myocellular uptake of [3H]chloroquine (endosomal pH), and [14C]palmitate, targeted lipidomics, and echocardiography. To confirm the involvement of v-ATPase in the beneficial effects of both supplementations, mTORC1/v-ATPase inhibitors (rapamycin/bafilomycin A1) were administered. Additionally, 2 heart-specific v-ATPase-knockout mouse models (subunits V1G1/V0d2) were subjected to these measurements. Mechanisms were confirmed in pharmacologically/genetically manipulated cardiomyocyte models of lipid overload. RESULTS: NMN successfully preserved endosomal acidification during myocardial lipid overload by maintaining v-ATPase activity and subsequently prevented CD36-mediated lipid accumulation, CD36-TLR4 interaction toward inflammation, fibrosis, cardiac dysfunction, and whole-body insulin resistance. Lipidomics revealed C18:1-enriched diacylglycerols as lipid class prominently increased by high-fat diet and subsequently reversed/preserved by lysine/leucine/arginine/NMN treatment. Studies with mTORC1/v-ATPase inhibitors and heart-specific v-ATPase-knockout mice further confirmed the pivotal roles of v-ATPase in these beneficial actions. CONCLUSION: NMN preserves heart function during lipid overload by preventing v-ATPase disassembly.
Assuntos
Cardiomiopatias , Resistência à Insulina , Animais , Camundongos , Ratos , Adenosina Trifosfatases , Arginina , Cardiomiopatias/induzido quimicamente , Cardiomiopatias/prevenção & controle , Antígenos CD36/genética , Fibrose , Inflamação , Leucina , Lipídeos , Lisina , Alvo Mecanístico do Complexo 1 de Rapamicina , Miócitos Cardíacos , Mononucleotídeo de Nicotinamida , Receptor 4 Toll-Like/genéticaRESUMO
Different types of cells uptake fatty acids in response to different stimuli or physiological conditions; however, little is known about context-specific regulation of fatty acid uptake. Here, we show that muscle injury induces fatty acid uptake in muscle stem cells (MuSCs) to promote their proliferation and muscle regeneration. In humans and mice, fatty acids are mobilized after muscle injury. Through CD36, fatty acids function as both fuels and growth signals to promote MuSC proliferation. Mechanistically, injury triggers the translocation of CD36 in MuSCs, which relies on dynamic palmitoylation of STX11. Palmitoylation facilitates the formation of STX11/SNAP23/VAMP4 SANRE complex, which stimulates the fusion of CD36- and STX11-containing vesicles. Restricting fatty acid supply, blocking fatty acid uptake, or inhibiting STX11 palmitoylation attenuates muscle regeneration in mice. Our studies have identified a critical role of fatty acids in muscle regeneration and shed light on context-specific regulation of fatty acid sensing and uptake.
Assuntos
Ácidos Graxos , Lipoilação , Músculo Esquelético , Proteínas Qa-SNARE , Regeneração , Animais , Humanos , Camundongos , Transporte Biológico , Antígenos CD36/metabolismo , Membrana Celular/metabolismo , Ácidos Graxos/metabolismo , Músculo Esquelético/lesões , Músculo Esquelético/fisiologia , Proteínas Qa-SNARE/metabolismoRESUMO
The scavenger receptor class B family proteins (SRB) are multiligand membrane receptor proteins. Herein, a novel SRB homolog (Pt-SRB2) was identified in Portunus trituberculatus. The open reading frame of Pt-SRB2 was predicted to encode 520 amino acid residues comprising a typical CD36 domain. Phylogenetic analysis showed that Pt-SRB2 distinctly clustered with the SRB homologs of most crustaceans and Drosophila but was separate from all vertebrate CD36/SRB. Semi-quantitative and Real-time quantitative PCR revealed that the abundance of Pt-SRB2 transcripts was the highest in hepatopancreas than in other tested tissues. Overexpressed Pt-SRB2 was distributed primarily in the cell membrane and cytoplasm of HEK293T or Drosophila Schneider 2 cells. In crab hemocytes, Pt-SRB2 was distributed primarily in the cell membrane by immunofluorescence staining. In addition, the immunofluorescence staining showed that green fluorescence signals were mainly located in the inner lumen membrane of the hepatopancreatic tubules. Moreover, solid-phase enzyme-linked immunosorbent assay revealed that rPt-SRB2-L exhibited relative high affinity with lipopolysaccharides, and relative moderate binding affinity with lipoteichoic acid or peptidoglycan. Of note, rPt-SRB2-L showed high binding affinity with eicosapentaenoic acid among a series of long-chain polyunsaturated fatty acids. Taken together, this study provided valuable data for understanding the functions of the crab CD36/SRB.
Assuntos
Braquiúros , Antígenos CD36 , Humanos , Animais , Antígenos CD36/genética , Braquiúros/genética , Sequência de Aminoácidos , Sequência de Bases , Filogenia , Células HEK293 , Drosophila/metabolismoRESUMO
Cluster of differentiation 36 (CD36) is a scavenger receptor expressed in various vertebrate cells that contains diverse ligands, including long-chain fatty acids. This receptor has recently been suggested as a captor of specific volatile odorants (e.g., aliphatic acetates) in the mammalian nasal epithelium. This study used a fluorescence-intensifying assay to produce the first evidence that lauric acid, an odorous fatty acid, directly binds to CD36. This expansion of the repertoire of volatile ligands supports potential applications for nasal CD36. Our present findings could promote future research aimed at understanding the mechanisms of fatty acid interactions with CD36.
Assuntos
Antígenos CD36 , Ácidos Graxos , Animais , Antígenos CD36/metabolismo , Fluorescência , Odorantes , Ácidos Láuricos , Mamíferos/metabolismoRESUMO
It has been found that the development of some cancers can be attributed to obesity, which is associated with the excessive intake of lipids. Cancer cells undergo metabolic reprogramming, shifting from utilizing glucose to fatty acids (FAs) for energy. CD36, a lipid transporter, is highly expressed in certain kinds of cancer cells. High expressions of CD36 in tumor cells triggers FA uptake and lipid accumulation, promoting rapid tumor growth and initiating metastasis. Meanwhile, immune cells in the tumor microenvironment overexpress CD36 and undergo metabolic reprogramming. CD36-mediated FA uptake leads to lipid accumulation and has immunosuppressive effects. This paper reviews the types of FAs associated with cancer, high expressions of CD36 that promote cancer development and progression, effects of CD36 on different immune cells in the tumor microenvironment, and the current status of CD36 as a therapeutic target for the treatment of tumors with high CD36 expression.